Adenovirus DNA: The Viral Genome and Its Expression by R. J. Roberts, G. Akusjarvi, P. Alestrom, R. E. Gelinas, T.

By R. J. Roberts, G. Akusjarvi, P. Alestrom, R. E. Gelinas, T. R. Gingeras (auth.), Walter Doerfler (eds.)

`This booklet will sincerely be of serious worth to these at once keen on adenovirus examine and will discover a wider viewers as a result of use of adenoviruses via molecular biologists learning the mechanisms of gene law. It represents comparatively cheap for cash not just since it is greatly established, yet as a result of significant numbers of references contained inside of it.'
The Society for common Microbiology Quarterly, thirteen (1986)

Show description

Read Online or Download Adenovirus DNA: The Viral Genome and Its Expression PDF

Similar viral books

Antiviral Methods and Protocols

Royal London university of drugs, united kingdom. moment writer, Raymond F. Schinazi, is at Emory Univ. , Decatur, GA. bargains simple and scientific researchers versions to guage compounds potent opposed to acute and protracted infections. contains accomplished assays, caliber trying out, and unpublished equipment. DNLM: Hepatitis, Viral, Human - drug treatment.

STI HIV 100% Condom Use Programme in Entertainment Establishments (A WPRO Publication)

The advisor defined that a hundred% Condom Use application is multisectoral and may concerned a sanction strategy. it really is written for decision-makers and technical employees within the assorted departments, together with Ministries of health and wellbeing. It units out the reason for this system and describes the stairs for its initiation and enlargement.

Malaria: Poverty, Race, and Public Health in the United States

In Malaria: Poverty, Race, and Public wellbeing and fitness within the usa, Margaret Humphreys provides the 1st book-length account of the parasitic, insect-borne affliction that has contaminated hundreds of thousands and inspired payment styles, fiscal improvement, and the standard of existence at each point of yankee society, specially within the south.

Chikungunya Virus: Methods and Protocols

This quantity covers multidisciplinary methods on numerous facets of Chikungunya Virus (CHIKV) examine that was once introduced jointly from major laboratories around the globe. subject matters lined contain ideas in medical and diagnostic virology, easy protocols in mobile and virus tradition, bioinformatics, and proteomics methods in mobile reaction reviews.

Extra info for Adenovirus DNA: The Viral Genome and Its Expression

Example text

T 15t,:RF 35937 "X> "" 34. II<: URF 14. 51<: DN ... ''L'_ _ 7_'_c<_'_ _ _ _' ... 13 JK (JRF ! ;. l. 3''"";----- - 5' Figure 2 Open reading frames, containing at least 100 amino-acids between the first AUG and the final terminator, present on the Ad2 genome. The complete reading frame from the preceding terminator to the final terminator is shaded. Within each reading frame the flag shows the position of the first AUG codon. The scale shows base number (upper) and percent coordinates (lower). The direction of transcription is indicated.

J +-~__+_______t_--+ ~- .. '1 ... -- i '; 52,551( pV11 pI! 9000 r----+-----+---- ----+--+-----+-------t---+----t--l - 18 1K UR. 71<: URF ]K ------~ 1--- --+- . lL_ DNA Poly",,,rase B. J... t 15t,:RF 35937 "X> "" 34. II<: URF 14. 51<: DN ... ''L'_ _ 7_'_c<_'_ _ _ _' ... 13 JK (JRF ! ;. l. 3''"";----- - 5' Figure 2 Open reading frames, containing at least 100 amino-acids between the first AUG and the final terminator, present on the Ad2 genome. The complete reading frame from the preceding terminator to the final terminator is shaded.

36~ .. 86~ Possible DONOR splice site for 33K mRNA • • 26600 TGCCTGTTCGCCGACCCAACCGTAGATGGGACACCACTGGAACCAGGGCCGGTAAGTCTAAGCAGCCGCCGCCGTTAGCCCAAGAGCAACAACAGCGCCA ACGGACAAGCGGCTGGGTTGGCATCTACCCTGTGGTGACCTTGGTCCCGGCCATTCAGATTCGTCGGCGGCGGCAATCGGGTTCTCGTTGTTGTCGCGGT 26500 ACACCGTCACCCTCGGTCGCATTCCCCTCGCCGGCGCCCCAGAAATTGGCAACCGTTCCCAGCATCGCTACAACCTCCGCTCCTCAGGCGCCGCCGGCAC TGTGGCAGTGGGAGCCAGCGTAAGGGGAGCGGCCGCGGGGTCTTTAACCGTTGGCAAGGGTCGTAGCGATGTTGGAGGCGAGGAGTCCGCGGCGGCCGTG ~ .... 82~ Cap sit. 92" Poly-A addition site for E3-1 mRNA.

Download PDF sample

Rated 4.07 of 5 – based on 21 votes